close
close
Posted in

Actin-nucleation promoting factor N-WASP influences alpha-synuclein condensates and pathology

Antibodies

The following primary antibodies were used in this study: mouse anti-alpha-synuclein (Bio Legend, 4B12/Synuclein, 807801), mouse anti-alpha-synuclein (Invitrogen, AHB0261), mouse anti-GFP (Roche, 11814460001), mouse anti-HA (Sigma, HA-7, H9658), rabbit anti-HA (Sigma, H6908), rabbit anti-N-WASP (Cell Signaling, 30D10, #4848), rabbit anti-N-WASP (polyclonal raised against peptide 385–401) (65), rabbit anti-N-WASP (Invitrogen, PA5-52198), mouse anti-synaptophysin 1 (SySy, 7.2, 101 0011), mouse anti-actin (Abcam, ab14128). Secondary antibodies used in this study were: HRP-conjugated anti-mouse secondary (Thermo Fisher Scientific), HRP-conjugated anti-rabbit secondary (Promega, W4011), Alexa Fluor™ 488-conjugated goat anti-mouse IgG (Invitrogen, A-11001), Alexa Fluor™ 568-conjugated goat anti-rabbit IgG (Invitrogen, A-11011) and Abberior STAR 488-conjugated goat anti-rabbit IgG (Abberior).

Caenorhabditis elegans strains

The following strains were used in this study: wild type N2 (Bristol), BAN419 gas-1(fc21)X;pkIs2386(unc-54p::α-syn::YFP+unc-119(+)), BAN534 wsp-1(gm324)IV, BAN550 wsp-1(gm324)IV;pkIs2386(unc-54p::α-syn::YFP+unc-119(+)), BAN686 shEx34(myo-3p::mCherry), BAN688 pkIs2386(unc-54p::alpha synuclein::YFP + unc-119(+));shEx34(myo-3p::mCherry), BAN689 wsp-1(gm324)IV;pkIs2386(unc-54p::alpha synuclein::YFP + unc-119(+));shEx34(myo-3p::mCherry), BAN690 shEx1(ges-1p::fat-7 + myo-3p::mCherry), BAN692 pkIs2386(unc-54p::alpha synuclein::YFP + unc-119(+));shEx1(ges-1p::fat-7 + myo-3p::mCherry), BAN693 wsp-1(gm324)IV;pkIs2386(unc-54p::alpha synuclein::YFP + unc-119(+));shEx1(ges-1p::fat-7 + myo-3p::mCherry), NL5901 pkIs2386(unc-54p::α-syn::YFP+unc-119(+)). Nematodes were maintained following standard culture methods as in some of our previous studies (47, 48, 51). All RNAi experiments were performed at indicated temperatures by feeding nematodes with HT115 E. coli expressing dsRNA against target genes. Some strains were provided by the CGC, which is funded by the NIH Office of Research Infrastructure Programs (P40 OD010440).

Cell cultures

HeLa cells and human embryonic kidney HEK293 and HEK293T cells were grown in DMEM (Gibco) supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin (100 U/ml penicillin; 100 mg/ml streptomycin). Cells were transfected with 2 µg of plasmid DNA using either Lipofectamine 2000 (Thermo Fisher Scientific) or Turbofectin (Origene) following the manufacturer’s instructions. For experiments in HeLa cells downregulating N-WASP, the siRNA (siRNA ID: 137396; Thermo Fisher Scientific) was transfected with Lipofectamine RNAiMAX (Thermo FisherScientific), 24 h prior to plasmid transfection with Lipofectamine 2000 for the transient protein expression. For co-IP mass spectrometry sample preparation, suspension cultures of Expi293F™ cells (HEK derivative) were used. Cultures were maintained in an Expi expression medium as described in the manufacturer’s protocol (8% CO2, 37 °C, 125 rpm). For protein expression, suspension cultures (30 ml) were transfected with 30 µg of plasmid DNA following the ExpiFectamine transfection guidelines.

B16-F1 cells were routinely grown in Dulbecco’s Modified Eagles Medium (DMEM, Gibco) supplemented with 10% FBS and 2 mM l-glutamine (Gibco) at 37 °C and in 5% CO2 atmosphere. CRISPR/Cas9-mediated disruption in B16-F1 cells of the Wasl encoding N-WASP was achieved essentially following standard procedures (66) and transfection of a vector harboring a CRISPR-gRNA sequence targeting exon 1 (5′-GAGAGACTCGTTCTCTTGCG-3′). Monoclonal cell lines were expanded from single-cell clones followed by screening for the absence of N-WASP expression by Western blotting (not shown). Selected clones devoid of N-WASP expression (Supplementary figure S1A) were confirmed to lack any Wasl wildtype allele by genotyping, as follows: sequences resulting from PCR amplification of the Wasl targeting region potentially harboring the site of disruption were subjected to Sanger sequencing and analysis by TIDE sequence trace decomposition (67). N-WASP expression was also assessed by western blot using a previously characterized triple KO cell line lacking Sra1, PIR121/CYFIP, and N-WASP (65) (Supplementary Fig. S1A).

Primary hippocampal neurons were prepared from P0 wild-type mice (C57BL6/J) as previously described (19). Neurons were seeded on coverslips and transfected using a standard calcium phosphate protocol. For single molecule tracking experiments, primary rat hippocampal neurons were used.

Induced-pluripotent stem cell (iPSC)-derived midbrain dopaminergic neurons (mDANs) were generated from smNPCs, as previously described (68, 69). Briefly, iPSC cultures were dissociated using accutase, centrifuged and resuspended in neural induction medium (DMEM-F12 (Invitrogen) 1:200 N2 supplement (Invitrogen), 1:100 B27 supplement without vitamin A (Invitrogen), 2 mM of GlutaMax, 10 μM of SB‐431542, 1 μM of dorsomorphin, 0.5 μM of purmorphamine, and 3 μM CHIR99021), supplemented with 10 μM of ROCK inhibitor (Tocris). Cells were cultured in nonadherent plates for 3 days, and on days 4–5, medium was changed to smNPC maintenance medium (neural induction medium lacking SB‐431542 and dorsomorphin, with 150 μM of ascorbic acid added). On day 6, embryoid bodies were triturated by pipetting and plated into Matrigel‐coated 12‐well plates. Cells were split using accutase and passaged for at least 6 splits to remove non-smNPC cells from the cultures. Subsequent differentiation into mDANs was initiated approximately 2 days after the previous passage. Medium was changed to mDAN induction medium (DMEM-F12 (Invitrogen) 1:200 N2 supplement (Invitrogen), 1:100 B27 supplement without vitamin A (Invitrogen), 100 ng/ml FGF8 (Invitrogen), 1 µM purmorphamine, and 200 µM Ascorbic Acid), and changed every 2–3 days. After 8 days, medium was changed to mDAN maturation medium (DMEM-F12 (Invitrogen) 1:200 N2 supplement (Invitrogen), 1:100 B27 supplement without vitamin A (Invitrogen), 10 ng/ml BDNF (PeproTech), 10 ng/ml GDNF (Peprotech), 1 ng/ml TGF-b3, 200 μM Ascorbic Acid, and 500 μM dbcAMP (Sigma)). On days 8-10, maturation medium was supplemented with 0.5 µM purmorphamine. On day 9, cultured cells were split 1:3 into small clumps using accutase. Cells were maintained in mDAN maturation medium until day 21. Transfection of shRNA (VectorBuilder, ID VB010000-9346qaz and VB900072-7764yby) was performed at day 10 with Lipofectamine 3000 (Invitrogen), and medium was changed the following day. For mDAN treatment, recombinant human α-synuclein (A140C) was purified from bacteria and labeled with Alexa Fluor™ 647 C2 Maleimide (Thermo Fisher Scientific) as previously described (19). The preformed fibrils were prepared by mixing 10:1 (unlabeled-to-labeled) α-synuclein, as previously described (70). Freshly sonicated α-Syn-Alexa Fluor 647 PFFs (100 nM final concentration) were added on day 14. On day 21, mDANs were fixed with warm 4% PFA/4% sucrose.

Co-immunoprecipitation for mass spectrometry analysis

Expi293 cells expressing either HA-tagged α-synuclein or mock controls were harvested 3 days after transfection. Cells were lysed in a buffer that contained 25 mM Tris-HCl pH 7.4, 150 mM NaCl, and 0.5 mM TCEP (buffer A) supplemented with complete EDTA-free Protease Inhibitor Cocktail (Roche) by three consecutive cycles of freezing and thawing. Soluble protein was separated from cellular debris by centrifugation at 20,000 × g at 4 °C for 45 min. Approximately 2000 µg of soluble protein supernatant was subjected to 100 µl of pre-equilibrated anti-HA agarose beads (Thermo Fisher Scientific, 26181) in a Poly-Prep® gravity flow chromatography column (Biorad) at 4 °C for 1.5 h with slow rotating agitation. Then, beads were washed with 10 ml of wash buffer (buffer A), and bound proteins were eluted with hot, non-reducing 2x SDS-PAGE loading buffer (125 mM Tris-HCl pH 6.8, 20% glycerol, 4% SDS, and 0.1% bromophenol blue).

Co-immunoprecipitations and western blot analysis

Co-IPs were performed using Immunoprecipitation kit (Abcam; catalog no.: ab206996) following the manufacturer’s instructions. Briefly, cells expressing HA-α-Syn or HA-YFP (48 h after transfection) were washed once with PBS and incubated with 2 mM dithiobis (succinimidyl propionate) (Thermo Fisher Scientific, PG82081) for 30 min for reversible crosslinking. The crosslinking reaction was stopped by incubating the cells with 25 mM Tris for 15 min. Cells were then washed with PBS and harvested in 500 μl cold nondenaturing lysis buffer (Abcam, ab206996). Cells were lysed at 4 °C for 30 min on a rotatory mixer. Lysates were cleared by centrifugation at 10,000 × g for 10 min, and protein concentration was determined using a Bradford assay. Approximately 500 μg of total protein was incubated with an anti-HA antibody (1:100) overnight at 4 °C on a rotatory mixer. Then, 40 μl of A/G Sepharose bead slurry was added to the protein–antibody mix and incubated for 1 h at 4 °C. Beads were then collected and washed by slow-speed centrifugation. Bound proteins were eluted from the beads by adding 40 μl 2× SDS-PAGE loading buffer (125 mM Tris-HCl pH 6.8, 4% SDS, 20% glycerol, 10% 2-mercaptoethanol, and 0.005% bromophenol blue) and boiling for 5 min.

Samples were resolved on 12% poly-acrylamide gels and transferred onto nitrocellulose membranes using semi-dry transfer Trans-Blot Turbo (Bio-Rad). Protein detection was performed using the following primary antibodies at a dilution of 1:1000, followed by HRP-conjugated secondary antibodies at a 1:2000 dilution. Immunoblots were developed in ECL and imaged using Chemidoc imaging system (Bio-Rad).

Confocal analysis and FRAP in vivo

Nematodes were transferred into a drop of 20 mM levamisole on a glass slide with a pad of 2% agarose, and a glass coverslip was gently placed on top. Animals were imaged for a maximum of 20 min following mounting on the slide. Z-stack images of alpha-synuclein inclusions were acquired from the head region, using a 20× objective and a Zeiss LSM900 confocal microscope. Inclusion size and number were assessed on maximum Z projections using ImageJ.

For FRAP analysis, animals were imaged using a 20× objective with 4× crop. Individual inclusions in the head to the animal were selected. Following image acquisition of 5 frames (<120 ms per frame), inclusions were photobleached, and subsequent fluorescent recovery was assessed for a further 95 frames. Intensity measurements of bleached region, whole cell, and background regions were performed using ImageJ. FRAP recovery curves were normalized using EasyFRAP web (71). The mobile fraction was calculated using the final intensity of normalized recovery curve.

Confocal live-cell imaging

Live-cell imaging was performed on a Nikon spinning disk confocal CSU-X microscope (Nikon Europe B.V., Düsseldorf, NRW, Germany) equipped with a temperature stage at 37 °C and a 5% CO2 saturation. A planar Apo objective 60x oil, NA 1.49 was used. Excitation wavelengths were: 405 nm for BFP; 488 nm for EGFP; 561 nm for mCherry. Image Analysis was done using ImageJ (Version: 1.8.0_172/1.53c).

For N-WASP condensation experiments, HEK293 cells were transfected with 2 µg of pCry2-mCh-N-WASP plasmid using Lipofectamine 2000. After 20 h, cells were imaged by confocal live-cell imaging (561 nm for mCherry) before and after photoactivation for 1 min (488 nm for Cry2, laser intensity at 2.4 mW output).

Gene ontology biological process pathway enrichment analysis by ClueGO and WormCat

Alpha-synuclein interaction partners were subjected to pathway enrichment analysis by ClueGO (v2.5.9), a plug-in application in Cytoscape (72) (v.3.9.1) (https://cytoscape.org,). The following parameters were used for ClueGO analysis, analysis mode: ClueGO (Functional Analysis); Loaded Marker List (Homo sapiens – 9606); ClueGO settings: Ontologies/Pathways (GO GO_BiologicalProcess-EBI-UniProt-GOA-ACAP-ARAP_25.05.2022), Evidence: All; Network specificity: medium; use of GO term Fusion; p value threshold ≤ 0.05 for pathway significance; GO Tree interval: 3 (minimum) and 8 (maximum) levels, GO term/pathway selection: 3 genes (minimum), 4% genes, and kappa score of 0.4, for GO term, pathway connectivity.

WormbaseIDs from upregulated and downregulated proteins obtained from proteomic analysis of nematode samples were entered into the online tool WormCat 2.0 (73). Significant Category 2 pathways were plotted using R (v. 4.3.1).

Lifespan analysis

Synchronized C. elegans populations were obtained by incubating gravid adult nematodes with hypochlorite solution, with the resulting eggs that were then transferred onto bacteria-seeded NGM plates. At L4/young adult stage, at least 180 animals (30 animals per plate) were transferred to fresh plates. Animals were transferred every 2 days until egg laying ceased, in order to eliminate offspring. Scoring for dead animals was performed every second day. Death was counted as a lack of touch-evoked movement, and censored animals were counted due to abnormal death (e.g., due to internal hatching). Survival curves were plotted and statistical analysis was performed using GraphPad Prism (GraphPad Software Inc., San Diego, USA).

Human protein-protein interaction profiling

Protein-Protein Interaction Profiling Service was performed on ProtoArray™ Human Protein Microarrays v5.1 (ThermoFisher Scientific, USA) as previously described (31). Briefly, microarrays were incubated with blocking buffer (50 mM Hepes, 200 mM NaCl, 0.08% Triton X 100, 25% glycerol, 20 mM glutathione, 1.0 mM DTT, and 1× synthetic block) at 4 °C for 1 h under gentle shaking. Following blocking, arrays were incubated with either monomeric or fibrillar human α-Syn, at two concentrations (5 and 50 ng/μl) diluted in probe buffer (1× PBS, 0.1% Tween-20, and 1× synthetic block) for 90 min at 4 °C. As a positive control, a microarray was incubated with 50 ng/ml of array control protein (i.e., yeast calmodulin kinase 1 with a biotin and V5 tags at the N terminus) diluted in probe buffer, and for a negative control one microarray was incubated with probe buffer alone. Following 5 washes with probe buffer at room temperature, microarrays were incubated with anti-α-Syn antibody in probe buffer for 90 min at 4 °C, followed by secondary antibody for 90 min at 4 °C. Following a final wash with probe buffer, arrays were washed with distilled water, dried by centrifugation at 1000 rpm for 1 min, and scanned using an Axon 4000B fluorescent microarray scanner (Molecular Devices). Candidate interactors were considered when the following conditions were satisfied: (a) the fluorescent intensity value was at least 20-fold higher than the corresponding negative control; (b) the normalized fluorescent signal was greater than three standard deviations; (c) the signal-to-noise ratio was higher than 0.5; and (d) the replicate spot coefficient of variation was lower than 50%.

Immunohistochemistry in cells

Cells on glass coverslips were washed once in PBS before fixing with 4% PFA in PBS for 15 min. Following three washes with PBS, cells were permeabilized and blocked with PBS containing 3% (w/v) BSA, 10 mM glycine, and 0.1% saponin (PBS/B) for 30 min. After blocking, coverslips were washed twice with PBS containing 0.1% saponin (PBS/S). Primary antibody incubation (in PBS/B) was performed for 2 h (dilution 1:500), followed by two PBS/S washes and subsequent incubation with fluorescently labeled secondary antibodies (dilution 1:500) in PBS/B for 45 min. After incubation, coverslips were washed three times with PBS/S and mounted on glass microscope slides using Fluoroshield with DAPI (Sigma, F6057) for imaging. For sample mounting samples, Fluoroshield without DAPI was used (Sigma, F6182). For immunohistochemistry of primary neurons, coverslips were washed once gently with PBS before fixing neurons with 4% PFA in PBS containing 4% (w/v) sucrose, 1 mM MgCl2, and 0.1 mM CaCl2 for 20 min at room temperature. Following three washes with PBS, cells were permeabilized with PBS containing 0.1% (v/v) Triton-X 100 (PBT) for 5 min. After blocking for 30 min in Blocker™ Casein (Thermo Fisher, 37528) supplemented with 0.1% Triton-X 100 (βCasT), coverslips were washed once in PBT. Primary antibody incubation (dilution: 1:500 in βCasT) was performed for 2 h, followed by two PBT washes and subsequent incubation with fluorescently labeled secondary antibodies (dilution: 1:400 in βCasT) for 45 min. After incubation, the coverslips were washed three times with PBT and mounted on glass microscope slides using Fluoroshield with DAPI (Sigma, F6057) for imaging.

Oil Red O (ORO) neutral lipid staining

Nematodes were washed off NGM plates, washed 3 times with H2O, flash-frozen in liquid nitrogen, and stored at −80 °C until required. On the day prior to staining, ORO stock solution (0.5% w/v in isopropanol) was diluted to 60% in distilled H2O and left at room temperature overnight. On the day of staining, ORO solution was filtered twice to remove insoluble precipitate. Pellets were thawed on ice and fixed with 4% PFA at 4 °C on a rotary mixer for 20 min. Fixed worms were washed in PBS, and subsequently dehydrated in 60% isopropanol. To each sample, 1 ml of ORO working solution was added and incubated overnight at room temperature on a rotary mixer. Stained animals were washed 3 times in PBS, and resuspended in 50 µl glycerol, before mounting on a glass slide. Images were acquired using Zeiss Epi-Scope1-Apotome. Staining intensity was measured using ImageJ.

Oxygen consumption rate (OCR) measurements

OCR was measured using a Seahorse XFe24 Analyzer (Agilent), using a modified protocol as previously described (47, 51). Briefly, synchronized animals were grown for 5 days at either 20 °C or 25 °C and transferred to freeze-killed OP50 plates for 2 h to empty their gut of live bacteria. Hydrated XFe24 sensor cartridges were calibrated, and the assay was run, at either 20 °C or 25 °C, depending on the initial growth conditions of the animals. Each well of a Seahorse XFe24 Cell Culture Microplate was filled with 500 μl M9 buffer, and 30 animals transferred into each well, with a minimum of 3 wells per condition. OCR measurements were taken at basal conditions, and in response to addition of 20 μM FCCP, followed by 20 mM sodium azide (NaN3).

PALM imaging of neurons and Single Particle Tracking (SPT)

The PALM microscope was a Nikon Ti Eclipse (Nikon France S.A.S., Champigny-sur-Marne, France) equipped with a Perfect Focus System (PFS), a motorized stage TI-S-ER, and an 18zimuthal Ilas² TIRF arm (Gataca Systems, Massy, France) coupled to a laser bench containing 405 nm (100 mW), 491 nm (150 mW), 532 nm (1 W), 561 nm (200 mW) and 642 nm (1 W) diodes. Images were recorded using objective Apo TIRF 100x oil NA 1.49 and a FusionBT sCMOS camera (Hamamatsu Photonics, Massy, France). Photo-conversion experiments were done using the Ilas² scanner system and a 405 nm laser diode while Illumination of the converted mEos3.2 fluorescent protein was exited using the 561 nm laser diode. To record protein trajectories streams of 4000 frames with an exposure time of 50 ms were acquired. The 37 °C atmosphere was created with an incubator box and an air heating system (Life Imaging Services, Basel, Switzerland). This system was controlled by MetaMorph software (Molecular Devices, Sunnyvale, USA).

SPT PALM experiments were analyzed using PALMTracer software, a MetaMorph (Molecular Devices, Sunnyvale, USA) add-on developed at the Interdisciplinary Institute of Neuroscience by Corey Butler (IINS -UMR5297 -CNRS/University of Bordeaux), Adel Mohamed Kechkar (Ecole Nationale Supérieure de Biotechnologie, Constantine, Algeria) and Jean-Baptiste Sibarita (IINS -UMR5297 -CNRS/University of Bordeaux). Briefly, single-molecule localization was achieved using wavelet segmentation, and then filtered out based on the quality of a 2D Gaussian fit. SPT analysis was then done based on the detections using reconnection algorithms and for MSD and D calculations on reconnected trajectories (74, 75).

Plasmids and DNA cloning

The following plasmids were used: α-synuclein-BFP (19), mCherry-Synapsin 1 and mCherry-(SH3) A-E (12), GFP-N-WASP (Addgene plasmid # 47406; kindly provided by Peter McPherson). mEOS3.2-N-WASP was generated by PCR of N-WASP from GFP-N-WASP (primer fwd: ATCACTCGAGTGAGCTCGGGCCAGCAG, primer rv: ATCAACTGCAGAATTCGAAGCTTTCAG) and subcloning into a pmEOS3.2-C1 backbone using XhoI and PstI. pCry2-mCh-N-WASP was generated by restriction enzyme-based cloning (KpnI/XhoI) of the N-WASP coding sequence into a pCry2-mCherry backbone plasmid (34).

Sample preparation, LC–MS/MS measurements, database searching, and SAINT analysis

Co-IP elution fractions were run using SDS-PAGE. In Gel digestion- Molecular weight bands were dissected from 18% SDS PAGE gels of anti-HA CoIP elution fractions derived from Expi293 cells either expressing empty HA-tagged vector or HA-tagged human SNCA wt. Excised gel bands were destained with 1:1 destain solutions A and B (Silverquest kit, #LC6070, Sigma Aldrich), reduced with 10 mM DTT and 2 mM TCEP in 100 mM ammonium bicarbonate and alkylated using 50 mM IAA in 100 mM ammonium bicarbonate for 30 min at room temperature and in the dark. In gel digestion was performed overnight at 30 °C with sufficient Trypsin (20 ng/μl; in 50 mM ammonium bicarbonate) to completely cover the gel pieces. Peptides were extracted from the gel slices by adding an equal volume of extraction buffer (1:2 (vol/vol) of 5% formic acid/ acetronitrile) and incubation at 37 °C with shaking for 15 min. Filter-aided sample preparation- young adult wt(N2), BAN534 wsp-1(gm324)IV, BAN550 wsp-1(gm324)IV;pkIs2386(unc-54p::α-Syn::YFP+unc-119(+)) and NL5901 pkIs2386(unc-54p::α-Syn::YFP+unc-119(+)) animals grown at 20 °C or 25 °C, were collected in water, spun down and stored at -80 °C until further processing. Samples were lysed in 200 μl Lysis buffer (50 mM HEPES (pH 7.4), 150 mM NaCl, 1 mM EDTA, 1.5% SDS, 1 mM DTT; supplemented with 1× protease and phosphatase inhibitor cocktail (ThermoScientific)). Lysis was aided by repeated cycles of sonication in a water bath (6 cycles of 1 min sonication (35 kHz) intermitted by 2 min incubation on ice). Approximately 20 µg of C. elegans protein lysates were reduced and alkylated prior to processing by a modified filter-aided sample preparation (FASP) protocol as previously described (76). Samples were digested overnight with Trypsin (1:20; in 50 mM ammonium bicarbonate) directly on the filters, at 30 °C and precipitated using an equal volume of 2 M KCl for depletion of residual detergents. Tryptic peptides were then cleaned, desalted on C18 stage tips and re-suspended in 20 µl 1% FA for LC-MS analysis. Extracted peptides were dried in a vacuum centrifuge and re-suspended in 30 μl of 5% formic acid for LC-MS analysis. MS runs were performed with at least 3 biological replicates.

Tryptic peptides were analyzed on a Dionex Ultimate 3000 RSLC nanosystem coupled to an Orbitrap Exploris 480 MS. Peptides were injected at starting conditions of 95% eluent A (0.1% FA in water) and 5% eluent B (0.1% FA in 80% ACN), with a flow rate of 300 nL/min. They were loaded onto a trap column cartridge (Acclaim PepMap C18, 100 Å, 5 mm × 300 μm i.d., #160454, Thermo Scientific) and separated by reversed-phase chromatography on an Acclaim PepMap C18, 100 Å, 75 µm × 25 cm (both columns from Thermo Scientific) using a 75 min linear increasing gradient from 5% to 31% of eluent B followed by a 20 min linear increase to 50% eluent B. The mass spectrometer was operated in data dependent and positive ion mode with MS1 spectra recorded at a resolution of 120 K, mass scan range of 375–1550, automatic gain control (AGC) target value of 300% (3 × 106) ions, maxIT of 25 ms, charge state of 2–7, dynamic exclusion of 60 s with exclusion after 1 time and a mass tolerance of 10 ppm. Precursor ions for MS/MS were selected using a top-speed method with a cycle time of 2 s. A decision tree was used to acquire MS2 spectra with a minimum precursor signal intensity threshold of 3 × 105 for scan priority one and an intensity range of 1 × 104 to 3 × 105 for scan priority two. Data-dependent MS2 scan settings were as follows: isolation window of 2 m/z, normalized collision energy (NCE) of 30% (High-energy Collision Dissociation (HCD), 7.5 K and 15 K resolution, AGC target value of 100% (1 × 105), maxIT set to 20 and 50 ms, for scan priority one and two, respectively. Full MS data were acquired in the profile mode with fragment spectra recorded in the centroid mode.

Raw data files were processed with Proteome Discoverer™ software (v2.5.0.400, Thermo Scientific) using SEQUEST® HT search engine against the Swiss-Prot® Homo sapiens (v2021-06-20) or Caenorhabditis elegans (v2022-12-14) databases. Peptides were identified by specifying trypsin as the protease, with up to 2 missed cleavage sites allowed and restricting peptide length between 7 and 30 amino acids. Precursor mass tolerance was set to 10 ppm, and fragment mass tolerance to 0.02 Da MS2. Static modifications were set as carbamidomethylated cysteine, while dynamic modifications included methionine and N-terminal loss of methionine, for all searches. Peptide and protein FDR were set to 1% by the peptide and protein validator nodes in the Consensus workflow. Default settings of individual nodes were used if not otherwise specified. In the Spectrum Selector node, the Lowest Charge State = 2 and Highest Charge State = 6 were used. The INFERYS rescoring node was set to automatic mode, and the resulting peptide hits were filtered for maximum 1% FDR using the Percolator algorithm in the Processing workflow. A second-stage search was activated to identify semi-tryptic peptides. Both unique and razor peptides were selected for protein quantification. Proteins identified by site, reverse or potential contaminants were filtered out prior to analysis.

SAINT analysis of SNCA IP was performed as previously described (77). Briefly PSMs of at least 3 biological replicates of HA only (control) and human SNCA associated protein complexes were uploaded into CRAPome with the following settings: Organism- H. sapiens, Experiment Type- Single step Epitope tag AP MS and Quantitation type- SPC. Probabilistic SAINT Score (SP), SAINT analysis was performed with user controls, averaging of biological replicates and 10 virtual controls. Prey proteins with a Probabilistic SAINT Score (SP) ≥ 0.5 were considered SNCA IP.

Raw MS data are publicly available under the following accession numbers- ProteomeXchange (PXD050719) and jPOST* (JPST002992) (78).

Sholl analysis

Fixed mDANs on coverslips were washed with PBS, stained with Hoechst, and mounted on glass slides using a fluorescent mounting medium (Dako). Individual cells expressing EGFP (successfully transfected with shRNA) were imaged using LSM900 with a 20x objective. For PFF-treated cells, the presence of Alexa Fluor 647 within the cell was confirmed prior to imaging. Sholl analysis was performed using the ImageJ Neuroanatomy plugin, on maximum Z projections, with a step size of 2um. Graphs were plotted using GraphPad Prism (GraphPad Software Inc., San Diego, USA). A linear mixed effect model was applied for statistical analysis by applying a published code adaption for R (79) and (https://zenodo.org/records/1158612).

Thrashing assay

Individual animals were transferred into a drop of M9 buffer on a glass slide. Each full-body bends (left to right to left again) were counted for a total of 90 s for each animal. Body bends for 8 animals per strain per experiment were assessed.